Allgemeine Chemie
Buchtipp
Wie funktioniert das?
H.-J. Altheide, A. Anders-von Ahlften, u.a.
23.00 €

Buchcover

Anzeige
Stichwortwolke
forum

Zurück   ChemieOnline Forum > Naturwissenschaften > Chemie > Allgemeine Chemie

Hinweise

Allgemeine Chemie Fragen zur Chemie, die ihr nicht in eines der Fachforen einordnen könnt, gehören hierher.

Anzeige

Antwort
 
Themen-Optionen Ansicht
Alt 08.10.2008, 16:19   #1   Druckbare Version zeigen
goodwin  
Mitglied
Themenersteller
Beiträge: 1
DNA Struktur und Form

Hallo zusammen!
Ich habe ein Riesenproblem. Im Gymnasium haben wir über die Ferien einen Take-Home-Test bekommen, den wir mit Hilfe von Internet etc. lösen sollen.
Bisher bin ich eigentlich recht gut vorangekommen, bis ich auf folgende Frage stiess:

Zeichnen Sie die beiden wahrscheinlichsten Monomer-Konformationen, d.h. einzelsträngigen Strukturen, des folgenden Polynukleotides:

5´ AUUACGUGGUGCACUCGGGGAACAUCCCGAGUGCACCACGUAAUGGA 3´

In wässriger Lösung liegen beide Formen im Gleichgewicht vor. Welche Form ist die vorherrschende? In anderen Worten, auf welcher Seite liegt das Gleichgewich? Warum?


Wie kommt man nun von dem Polynukleotid auf diese beiden wahrscheinlichsten einzelsträngigen Strukturen? Ich habe bei Google leider nichts gefunden und bin echt am verzweifeln bei dieser Aufgabe.

Danke schon im Voraus!
Grüsse Goodwin
goodwin ist offline   Mit Zitat antworten
Anzeige
Anzeige


Antwort

Lesezeichen

Themen-Optionen
Ansicht

Gehe zu

Ähnliche Themen
Thema Autor Forum Antworten Letzter Beitrag
Welche Effekte auf die Struktur der DNA-Doppelhelix sind bei folgenden Behandlungen zu erwarten Julka20 Biologie & Biochemie 1 20.01.2012 20:30
DNA Product bei fehlender DNA POL I und Ligase anne.ker Biologie & Biochemie 1 06.08.2011 09:58
In welcher Form wird glucose in glykogen eingebaut (und wie ensteht diese Form , welches Enzym ist für en Abbau von Glykogen verantwortlich und welche Form der Glucose entsteht dabei . latrell Biologie & Biochemie 4 09.09.2008 09:58
Antikörper, DNA und Proteine - Masse und Struktur von komplexen Biomolekülen in Lösun tbeyer Nachrichten aus Wissenschaft und Forschung 0 18.12.2006 10:10
Die Aufklärung der DNA-Struktur - 50 Jahre danach JJFox Biologie & Biochemie 0 24.01.2003 12:00


Alle Zeitangaben in WEZ +2. Es ist jetzt 21:39 Uhr.



Anzeige