Biologie & Biochemie
Buchtipp
Molekulare Genetik
R. Knippers
49,95 €

Buchcover

Anzeige
Stichwortwolke
forum

Zurück   ChemieOnline Forum > Naturwissenschaften > Biologie & Biochemie

Hinweise

Biologie & Biochemie Ein Forum für Molekularbiologie, Genetik, Gentechnik und andere biologische sowie biochemische Themen.

Anzeige

Antwort
 
Themen-Optionen Ansicht
Alt 09.08.2018, 12:05   #1   Druckbare Version zeigen
Suunygirl weiblich 
Mitglied
Themenerstellerin
Beiträge: 2
Frage zu Primern

Hallo ich stehe vor folgender Aufgabe und weiß leider nicht wie ich vorgehen soll...
Die Aufgabe lautet:
Sie wollen Gen X mittels PCR amplifizieren. Einen Ausschnitt des Sense￾Strangs des Gens mit Start- und Stop-Codon finden Sie untenstehend. Bitte
designen Sie ein PCR-Primer-Paar (12mere), um das Gen zu amplifizieren, und
markieren Sie jeweils das 3‘ und 5‘-Ende der Primer. Bitte achten Sie darauf,
dass die komplette Coding-Region amplifiziert wird. Optimale Annealing￾Temperaturen müssen an dieser Stelle nicht

GACTGGATAGTCCAATGCATGTGAGTGGATGGGCCAC->
>- TTCGACGCCACCGGTACACCTAAGGGACATTTCAAAAGACG

Ich wäre über eine Hilfe sehr dankbar

Geändert von Suunygirl (09.08.2018 um 12:14 Uhr)
Suunygirl ist offline   Mit Zitat antworten
Alt 10.08.2018, 09:58   #2   Druckbare Version zeigen
Lucas76 Männlich
Mitglied
Beiträge: 629
AW: Frage zu Primern

Für die ersten 12 Nucleotide des Start-Codons und die letzten 12 des Stopp-codons müssen die Komplementärbasen aufgeschrieben werden.

A -> T
T -> A
C -> G
G -> C

Start-Codon: "Anfang(3' od 5') : CTGACCTATCAG---------- und dann das selbe für's Stopp-Codon

Für den Komplementär-Basen-Strang könnte man das selbe machen.
Lucas76 ist offline   Mit Zitat antworten
Anzeige
Alt 10.08.2018, 10:35   #3   Druckbare Version zeigen
imalipusram  
Mitglied
Beiträge: 6.419
AW: Frage zu Primern

GACTGGATAGTCCAATGCATGTGAGTGGATGGGCCAC->
>- TTCGACGCCACCGGTACACCTAAGGGACATTTCAAAAGACG

1. Mögliche Start- und Stop- Codons suchen (hab ich mal fett hervorgehoben). BTW, das letzte der 3 ATGs ist am wahrscheinlichsten bei Eukaryonten (Kozak Consensus Element, GC-reich, Prototyp: GCCGCCatGG). Das 2. ATG ist vermutlich nicht der Start, da dahinter gleich ein Stop im Raster folgt (TGA).
2. Primersequenz darf incl. Start bzw. Stop 12 Basen in die codierende Sequenz reinragen. Möglicher Bereich ist unterstrichen.
3. 12 Basen lange Stücke auswählen, für den codierenden Strang ist das schon 5'->3'
4. Für den Gegenstrang das reverse Komplement bilden, das ist dann auch 5'->3'
4a evtl. checken, ob sich nicht fürchterliche Hairpins bilden oder die beiden Primer (teilweise) komplementär sind (sprengt vermutlich den Erwartungshorizont).
5. fertig!
__________________
I solemnly swear that I'm up to no good!
伍佰 (WuBai - Run run run!) (ein Musikvideo mit dem Bambushaus und dem imalipusram unter den Statisten)
Noch ein nettes Video (nerdy, ein LIHA-Robot)
Und so gehts hier manchmal zu (sowas Ähnliches wie Fronleichnam, hier wird TuDiGong, dem Erdgott, tüchtig eingeheizt!) Oder so (auch ungeeignet für Gefahrstoffphobiker) und so und so.

Geändert von imalipusram (10.08.2018 um 10:42 Uhr)
imalipusram ist offline   Mit Zitat antworten
Alt 10.08.2018, 14:23   #4   Druckbare Version zeigen
Suunygirl weiblich 
Mitglied
Themenerstellerin
Beiträge: 2
AW: Frage zu Primern

Vielen Dank für die Antworten. Ich habe nun versucht die Aufgabe zu lösen und habe dabei bemerkt, dass Start und Stoppcodon in der Aufgabenstellung gegeben waren.

Das war der vorgegebene Strang mit Start und Stoppcodon.

GACTGGATAGTCCAATGCATGTGAGTGGATGGGCCAC--------------->

>-----------TTCGACGCCACCGGTACACCTAAGGGACATTTCAAAAGACG

Nun bin ich so vorgegangen ich habe es so verstanden, dass mein vorgegebener Strang der Sense Strang ist also der 5`-3` Strang ist zudem habe ich den komplementären Strang 3`-5` gebildet. Der Forward Primer ergibt sich aus den ersten 12 Basen des 3´-5´ Stranges und der Reverse Primer aus den 12 Basen vor dem Stoppcodon des 5´-3´ Stranges.
So sieht mein Ergebnis dann aus.

5`ATGCATGTGAGTGGATGGGCCACTTCGACGCCACCGGTACACCTAA 3`
3`TACGTACACTCACCTACCCGGTGAACCTGCGTGGCCATGTGGATT 5`

Forward Primer: 3` GTACACTCACCT 5`
Reverse Primer: 5` CACCGGTACACC 3`

ich weiß nicht, ob es so richtig ist und was mit noch unklar ist, muss ich immer die ersten 12 Basen nach bzw. vor dem Start/Stoppcodon nehmen ?

Über eine Rückmeldung würde ich mich freuen und bedanke mich sehr im voraus.
Gruß
Suunygirl ist offline   Mit Zitat antworten
Anzeige


Antwort

Themen-Optionen
Ansicht

Gehe zu

Ähnliche Themen
Thema Autor Forum Antworten Letzter Beitrag
Gen finden mit gegebenen Primern Vertigo Biologie & Biochemie 8 20.10.2012 09:39
Schmelztemperatur Tm von Primern ausrechnen MartinM123 Biologie & Biochemie 2 04.09.2012 16:23
Schmelztemperatur von Primern Cherie4maus Biologie & Biochemie 2 19.04.2009 16:26
RE sites in PCR primern Cistron Biologie & Biochemie 3 19.01.2007 14:13
pcr - selbstkomplementarität von primern moni Biologie & Biochemie 3 21.01.2005 23:08


Alle Zeitangaben in WEZ +2. Es ist jetzt 18:41 Uhr.



Anzeige