Anzeige


Einzelnen Beitrag anzeigen
Alt 08.10.2008, 16:19   #1   Druckbare Version zeigen
goodwin  
Mitglied
Themenersteller
Beiträge: 1
DNA Struktur und Form

Hallo zusammen!
Ich habe ein Riesenproblem. Im Gymnasium haben wir über die Ferien einen Take-Home-Test bekommen, den wir mit Hilfe von Internet etc. lösen sollen.
Bisher bin ich eigentlich recht gut vorangekommen, bis ich auf folgende Frage stiess:

Zeichnen Sie die beiden wahrscheinlichsten Monomer-Konformationen, d.h. einzelsträngigen Strukturen, des folgenden Polynukleotides:

5´ AUUACGUGGUGCACUCGGGGAACAUCCCGAGUGCACCACGUAAUGGA 3´

In wässriger Lösung liegen beide Formen im Gleichgewicht vor. Welche Form ist die vorherrschende? In anderen Worten, auf welcher Seite liegt das Gleichgewich? Warum?


Wie kommt man nun von dem Polynukleotid auf diese beiden wahrscheinlichsten einzelsträngigen Strukturen? Ich habe bei Google leider nichts gefunden und bin echt am verzweifeln bei dieser Aufgabe.

Danke schon im Voraus!
Grüsse Goodwin
goodwin ist offline   Mit Zitat antworten
 


Anzeige